| Detail of EST/Unigene AL385768 |
| Acc. | AL385768 |
| Internal Acc. | MtBC30E07F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Malonate--CoA ligase OS=Arabidopsis thaliana E-value=9e-55; Acyl-CoA synthetase family member 3, mitochondrial OS=Mus musculus E-value=1e-22; Acyl-CoA synthetase family member 3, mitochondrial OS=Homo sapiens E-value=2e-21; Acyl-CoA synthetase family member 3, mitochondrial OS=Bos taurus E-value=8e-21; Acyl-CoA synthetase family member 3, mitochondrial OS=Xenopus laevis E-value=2e-20; |
| Length | 406 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | CACACAGAAGCATCCTTGCTCAGGTCCAAACATTGACAAAAGCATGGGGGTACACATCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820862 |
| Trichome-related Gene from Literature | N/A |