Detail of EST/Unigene AL385769 |
Acc. | AL385769 |
Internal Acc. | MtBC30E07R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Malonate--CoA ligase OS=Arabidopsis thaliana E-value=7e-27; Acyl-CoA synthetase family member 3, mitochondrial OS=Mus musculus E-value=4e-11; Acyl-CoA synthetase family member 3, mitochondrial OS=Homo sapiens E-value=7e-11; Acyl-CoA synthetase family member 3, mitochondrial OS=Bos taurus E-value=1e-10; Acyl-CoA synthetase family member 3, mitochondrial OS=Xenopus laevis E-value=3e-10; |
Length | 501 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | TCTCAGAATGTTGCGTTTTGGGCTTACCGGACAAAGACTACGGAGAAATTGTTTGTGCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase |
EC | 6.2.1.1 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820862 |
Trichome-related Gene from Literature | N/A |