| Detail of EST/Unigene AL385840 |
| Acc. | AL385840 |
| Internal Acc. | MtBC31A08F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferritin-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; Ferritin-3, chloroplastic OS=Glycine max E-value=2e-10; Ferritin-4, chloroplastic OS=Glycine max E-value=5e-10; Ferritin-2, chloroplastic OS=Vigna unguiculata E-value=5e-10; Ferritin-2, chloroplastic OS=Nicotiana tabacum E-value=2e-09; |
| Length | 234 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | GACCAAAAACAACCCACATAAACTTTATTAAAGCGTGGTTCAGTTCCAACTACTAGTTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820276 |
| Trichome-related Gene from Literature | N/A |