| Detail of EST/Unigene AL386663 |
| Acc. | AL386663 |
| Internal Acc. | MtBC36B04F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Peptidyl-prolyl cis-trans isomerase F, mitochondrial OS=Rattus norvegicus E-value=8e-54; Peptidyl-prolyl cis-trans isomerase F, mitochondrial OS=Mus musculus E-value=8e-54; Peptidyl-prolyl cis-trans isomerase F, mitochondrial OS=Homo sapiens E-value=1e-53; Peptidyl-prolyl cis-trans isomerase OS=Drosophila melanogaster E-value=7e-53; Peptidyl-prolyl cis-trans isomerase F, mitochondrial OS=Bos taurus E-value=1e-52; |
| Length | 475 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | GCCGGTAAAAGTAAAACCCAGGATATTAACACTGCGGAGCATTTAGGTAAAATCGTATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 5.2.1.8 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816648 |
| Trichome-related Gene from Literature | N/A |