| Detail of EST/Unigene AL386840 |
| Acc. | AL386840 |
| Internal Acc. | MtBC37B09R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | SKP1-like protein 1A OS=Arabidopsis thaliana E-value=1e-48; SKP1-like protein 1B OS=Arabidopsis thaliana E-value=2e-47; SKP1-like protein 4 OS=Arabidopsis thaliana E-value=1e-42; SKP1-like protein 11 OS=Arabidopsis thaliana E-value=6e-40; SKP1-like protein 12 OS=Arabidopsis thaliana E-value=2e-39; |
| Length | 505 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | ATCGAAGATGATTGCGCTGACAGTGGAATCCCTCTTCCCAACGTTACCAGCAAGATCTTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03094 S-phase kinase-associated protein 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843928 |
| Trichome-related Gene from Literature | N/A |