| Detail of EST/Unigene AL387420 |
| Acc. | AL387420 |
| Internal Acc. | MtBC42D08F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3(4)-beta-glucanase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-23; Endo-1,3(4)-beta-glucanase 1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=1e-19; Putative endo-1,3(4)-beta-glucanase 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-18; Endo-1,3(4)-beta-glucanase 2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-17; |
| Length | 494 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | AATTTTTTGAAGGAAACTATTGAGCCATGGTTGGATGGAAATTTCAAAGGGAATGGTTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838411 |
| Trichome-related Gene from Literature | N/A |