| Detail of EST/Unigene AL387765 |
| Acc. | AL387765 |
| Internal Acc. | MtBC44E11R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NADP-dependent D-sorbitol-6-phosphate dehydrogenase OS=Malus domestica E-value=2e-26; Aldose reductase A OS=Dictyostelium discoideum E-value=1e-15; Aldose reductase OS=Bos taurus E-value=3e-15; Aldose reductase OS=Sus scrofa E-value=4e-14; 3-oxo-5-beta-steroid 4-dehydrogenase OS=Homo sapiens E-value=4e-14; |
| Length | 511 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | GGTTTGGTACAGAGTCATGTTTGGATGAGCAAATTCTCAAAGGTCTAGCTGAAAAATACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
| EC | 1.1.1.149 1.1.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816664 |
| Trichome-related Gene from Literature | N/A |