Detail of EST/Unigene AL388046 |
Acc. | AL388046 |
Internal Acc. | MtBC46C08R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thiamine thiazole synthase, chloroplastic OS=Citrus sinensis E-value=5e-27; Thiamine thiazole synthase, chloroplastic OS=Arabidopsis thaliana E-value=4e-26; Thiamine thiazole synthase, chloroplastic OS=Alnus glutinosa E-value=9e-26; Thiamine thiazole synthase 2, chloroplastic OS=Vitis vinifera E-value=9e-26; Thiamine thiazole synthase 1, chloroplastic OS=Zea mays E-value=8e-24; |
Length | 342 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | GAAGTTGTTCCTGGTATGATTGTTACTGGTATGGAAGTTGCTGAAATTGATGGTGCCCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835567 |
Trichome-related Gene from Literature | N/A |