| Detail of EST/Unigene AL388245 |
| Acc. | AL388245 |
| Internal Acc. | MtBC47E01R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Uncharacterized oxidoreductase ykwC OS=Bacillus subtilis (strain 168) E-value=2e-28; 2-hydroxy-3-oxopropionate reductase OS=Escherichia coli (strain K12) E-value=2e-16; Uncharacterized oxidoreductase Sfri_1503 OS=Shewanella frigidimarina (strain NCIMB 400) E-value=7e-15; Uncharacterized oxidoreductase slr0229 OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=5e-13; 2-hydroxy-3-oxopropionate reductase OS=Escherichia coli (strain K12) E-value=7e-13; |
| Length | 523 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | GGGAACTAGTGGAAAAGGTCAATTCGTGAAGCTAGCGAATCAGATAACGATAGCTTCAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00020 3-hydroxyisobutyrate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00033 6-phosphogluconate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00033 6-phosphogluconate dehydrogenase |
| EC | 1.1.1.31 1.1.1.44 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829033 |
| Trichome-related Gene from Literature | N/A |