Detail of EST/Unigene AL388247 |
Acc. | AL388247 |
Internal Acc. | MtBC47E02R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=1e-08; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=4e-08; Beta-fructofuranosidase, insoluble isoenzyme 2 OS=Daucus carota E-value=1e-07; Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=1e-07; Fructan 6-exohydrolase OS=Beta vulgaris E-value=2e-07; |
Length | 346 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | GGAGAGCTTGCATAACAAGTAGAGCTTATCCCTTATTTGCTACAGATAAAGATGCACATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |