| Detail of EST/Unigene AL388887 |
| Acc. | AL388887 |
| Internal Acc. | MtBC51D07F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase AtPK2/AtPK19 OS=Arabidopsis thaliana E-value=4e-63; Serine/threonine-protein kinase AtPK1/AtPK6 OS=Arabidopsis thaliana E-value=8e-63; Protein kinase 2 OS=Dictyostelium discoideum E-value=4e-39; Ribosomal protein S6 kinase beta-1 OS=Rattus norvegicus E-value=1e-37; Ribosomal protein S6 kinase beta-1 OS=Oryctolagus cuniculus E-value=1e-37; |
| Length | 494 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | TTTTTTCAGCTTTATCACCAGGCCTTTTCAGAGAGGATCTAGCACGCATATACGCAGCCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04688 p70 ribosomal S6 kinase |
| EC | 2.7.11.1 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
| Probeset |
|
| Corresponding NCBI Gene | 820019 |
| Trichome-related Gene from Literature | N/A |