| Detail of EST/Unigene AL388935 |
| Acc. | AL388935 |
| Internal Acc. | MtBC51F11R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Pleckstrin homology domain-containing protein 1 OS=Arabidopsis thaliana E-value=1e-48; PH domain-containing protein DDB_G0274775 OS=Dictyostelium discoideum E-value=1e-12; Cytohesin-3 OS=Mus musculus E-value=1e-11; Cytohesin-2 OS=Chlorocebus aethiops E-value=1e-10; Cytohesin-1 OS=Rattus norvegicus E-value=2e-10; |
| Length | 516 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | TGGTCGAACCCAGAACGAACCGGCTGGTTAACAAAACAAGGCGAATACATAAAAACATGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04456 RAC serine/threonine-protein kinase |
| EC | 2.7.11.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830455 |
| Trichome-related Gene from Literature | N/A |