| Detail of EST/Unigene AL388957 |
| Acc. | AL388957 |
| Internal Acc. | MtBC51G12R1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S18, chloroplastic OS=Cucumis sativus E-value=1e-15; 30S ribosomal protein S18, chloroplastic OS=Lactuca sativa E-value=4e-15; 30S ribosomal protein S18, chloroplastic OS=Aethionema cordifolium E-value=5e-15; 30S ribosomal protein S18, chloroplastic OS=Pisum sativum E-value=7e-15; 30S ribosomal protein S18, chloroplastic OS=Panax ginseng E-value=9e-15; |
| Length | 463 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | TGCTTGTGTGTCACCCTTAGGAGGTAAATTCTAGAAATTAGATTCTATAAATTATATATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |