Detail of EST/Unigene AL388957 |
Acc. | AL388957 |
Internal Acc. | MtBC51G12R1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S18, chloroplastic OS=Cucumis sativus E-value=1e-15; 30S ribosomal protein S18, chloroplastic OS=Lactuca sativa E-value=4e-15; 30S ribosomal protein S18, chloroplastic OS=Aethionema cordifolium E-value=5e-15; 30S ribosomal protein S18, chloroplastic OS=Pisum sativum E-value=7e-15; 30S ribosomal protein S18, chloroplastic OS=Panax ginseng E-value=9e-15; |
Length | 463 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | TGCTTGTGTGTCACCCTTAGGAGGTAAATTCTAGAAATTAGATTCTATAAATTATATATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |