| Detail of EST/Unigene AL389379 |
| Acc. | AL389379 |
| Internal Acc. | MtBC54E05F1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 39S ribosomal protein L10, mitochondrial OS=Bos taurus E-value=3e-10; 39S ribosomal protein L10, mitochondrial OS=Homo sapiens E-value=4e-10; 39S ribosomal protein L10, mitochondrial OS=Rattus norvegicus E-value=6e-10; 54S ribosomal protein L11, mitochondrial OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=1e-09; 39S ribosomal protein L10, mitochondrial OS=Mus musculus E-value=9e-09; |
| Length | 498 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS; |
| Sequence | AGGTTTACCTTTATAATTTATATTACGCGCAACTTCATTTTAATAGATTGGTTTTTATAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |