Detail of EST/Unigene AL389438 |
Acc. | AL389438 |
Internal Acc. | MtBC54H02F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase T1 OS=Arabidopsis thaliana E-value=3e-49; Glutathione S-transferase T3 OS=Arabidopsis thaliana E-value=1e-45; Glutathione S-transferase T2 OS=Arabidopsis thaliana E-value=1e-45; Glutathione S-transferase theta-2 OS=Rattus norvegicus E-value=2e-25; Glutathione S-transferase theta-2 OS=Mus musculus E-value=2e-25; |
Length | 493 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | GTTTTGTTAATTAAAAGAAAGAATACAATGAGATAAGAGAGAGAAATCAAGCCAAAGTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834123 |
Trichome-related Gene from Literature | N/A |