Detail of EST/Unigene AL389506 |
Acc. | AL389506 |
Internal Acc. | MtBC55C08F1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-carotene hydroxylase 2, chloroplastic (Fragment) OS=Capsicum annuum E-value=6e-22; Beta-carotene 3-hydroxylase 1, chloroplastic OS=Arabidopsis thaliana 1 E-value=1e-21; Beta-carotene 3-hydroxylase 2, chloroplastic OS=Arabidopsis thaliana 2 E-value=5e-19; Beta-carotene hydroxylase 1, chloroplastic OS=Capsicum annuum E-value=5e-19; Beta-carotene 3-hydroxylase, chloroplastic OS=Gentiana lutea E-value=5e-18; |
Length | 462 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS; |
Sequence | CATCAAGTTTTTTCAACTCAAAAAAACCAAACTTCACCTATGGCGGCAGGACTAACCGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |