| Detail of EST/Unigene ALFCRP |
| Acc. | ALFCRP |
| Internal Acc. | |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L22, chloroplastic OS=Medicago sativa E-value=2e-86; 50S ribosomal protein L22, chloroplastic OS=Pisum sativum E-value=7e-61; 50S ribosomal protein L22, chloroplastic OS=Solanum lycopersicum E-value=8e-36; 50S ribosomal protein L22, chloroplastic OS=Solanum bulbocastanum E-value=8e-36; 50S ribosomal protein L22, chloroplastic OS=Solanum tuberosum E-value=2e-35; |
| Length | 807 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_CDS (1 ESTs); |
| Sequence | CAATGGCTCTTTCTTTAACCGCCATTAACCTTCCTCCTCCTCCTCTTCGCGATAACCTAC |
| EST members of Unigene | ALFCRP |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2573.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |