Detail of EST/Unigene AM407888 |
Acc. | AM407888 |
Internal Acc. | |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=0; |
Length | 700 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_CDS (1 ESTs); |
Sequence | CCTTTTTTTTTGATGACTCCTTCGGGTTTGAGCAGTACGTTGATTTTGCTCTTGATGTTC |
EST members of Unigene | AM407888 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.26628.1.S1_s_at
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |