Detail of EST/Unigene AM407891 |
Acc. | AM407891 |
Internal Acc. | |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Phospholipid hydroperoxide glutathione peroxidase, chloroplastic OS=Pisum sativum E-value=0; Phospholipid hydroperoxide glutathione peroxidase 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-84; Putative glutathione peroxidase 7, chloroplastic OS=Arabidopsis thaliana E-value=1e-82; Probable phospholipid hydroperoxide glutathione peroxidase 6, mitochondrial OS=Arabidopsis thaliana E-value=5e-65; Probable phospholipid hydroperoxide glutathione peroxidase OS=Mesembryanthemum crystallinum E-value=8e-65; |
Length | 703 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_CDS (1 ESTs); |
Sequence | TGGTTTCCATGGCTTCTTTCACAACCTTCTTCACACCTCTTCACAATTTCAATCAAGCTA |
EST members of Unigene | AM407891 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
EC | 1.11.1.12 1.11.1.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.48948.1.S1_at
|
Corresponding NCBI Gene | 817046 |
Trichome-related Gene from Literature | N/A |