| Detail of EST/Unigene AM783916 |
| Acc. | AM783916 |
| Internal Acc. | AM783916 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ras-related protein ced-10 OS=Caenorhabditis elegans E-value=5e-35; Ras-related protein rac-2 OS=Caenorhabditis elegans E-value=3e-34; Ras-related C3 botulinum toxin substrate 2 OS=Bos taurus E-value=3e-34; Ras-related protein Rac1 OS=Drosophila melanogaster E-value=1e-33; Cdc42 homolog OS=Aedes aegypti E-value=2e-33; |
| Length | 489 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_DL (1 ESTs); |
| Sequence | ATTTTTGAATTTTTTATTGTAAATCAACAAGACTTGGTTTCTTTCGAGCTATATATTTTA |
| EST members of Unigene | AM783916 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K07860 Ras-related C3 botulinum toxin substrate 2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K07860 Ras-related C3 botulinum toxin substrate 2; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K07860 Ras-related C3 botulinum toxin substrate 2 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816290 |
| Trichome-related Gene from Literature | 816290 |