| Detail of EST/Unigene AM784019 |
| Acc. | AM784019 |
| Internal Acc. | AM784019 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-aminocyclopropane-1-carboxylate synthase 7 OS=Arabidopsis thaliana E-value=4e-35; 1-aminocyclopropane-1-carboxylate synthase OS=Malus domestica E-value=4e-31; 1-aminocyclopropane-1-carboxylate synthase 3 OS=Solanum lycopersicum E-value=6e-31; 1-aminocyclopropane-1-carboxylate synthase CMA101 OS=Cucurbita maxima E-value=8e-31; 1-aminocyclopropane-1-carboxylate synthase 9 OS=Arabidopsis thaliana E-value=2e-29; |
| Length | 454 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_DL (1 ESTs); |
| Sequence | GCTGGACACTGAGAATCGTTGTTTGAAATATTTACCATTATTGTCTTATTTTACTTTTTT |
| EST members of Unigene | AM784019 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
| EC | 2.6.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828726 |
| Trichome-related Gene from Literature | 828726 |