| Detail of EST/Unigene AM786004 |
| Acc. | AM786004 |
| Internal Acc. | AM786004 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-15; Gamma-glutamyltranspeptidase 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-15; Gamma-glutamyltransferase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=7e-15; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=2e-14; Gamma-glutamyltransferase light chain 1 OS=Homo sapiens E-value=2e-14; |
| Length | 510 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_DL (1 ESTs); |
| Sequence | GCTATCTGCATCCATTCCATAATCGATGACGTTGAGAATGCTCTATTAACAAAAAGAAAC |
| EST members of Unigene | AM786004 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
| EC | 2.3.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829042 |
| Trichome-related Gene from Literature | 829042 |