Detail of EST/Unigene AM793024 |
Acc. | AM793024 |
Internal Acc. | AM793024 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cystathionine beta-synthase OS=Dictyostelium discoideum E-value=6e-69; Cystathionine beta-synthase OS=Oryctolagus cuniculus E-value=1e-60; Cystathionine beta-synthase OS=Macaca fascicularis E-value=1e-60; Cystathionine beta-synthase OS=Rattus norvegicus E-value=1e-60; Cystathionine beta-synthase OS=Mus musculus E-value=1e-60; |
Length | 516 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_DL (1 ESTs); |
Sequence | GCTGTTTGAACAAAATCCAAAAGAATACGGACTTAAATGCGACCTAGTCGCCAAGTGTGA |
EST members of Unigene | AM793024 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase |
EC | 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827145 |
Trichome-related Gene from Literature | 827145 |