| Detail of EST/Unigene AM793090 |
| Acc. | AM793090 |
| Internal Acc. | AM793090 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Actin, alpha skeletal muscle OS=Oryzias latipes E-value=4e-20; Actin, alpha skeletal muscle OS=Oreochromis mossambicus E-value=4e-20; Actin, alpha skeletal muscle B OS=Takifugu rubripes E-value=4e-20; Actin, alpha skeletal muscle A OS=Takifugu rubripes E-value=4e-20; Actin, muscle OS=Styela clava E-value=4e-20; |
| Length | 489 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_SL (1 ESTs); |
| Sequence | TTCTAAATCAATAAAAATAAAAGAATAAGATCATCCAGCAATCAACTCCTTTCAATCAAA |
| EST members of Unigene | AM793090 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836056 |
| Trichome-related Gene from Literature | 836056 |