Detail of EST/Unigene AM827440 |
Acc. | AM827440 |
Internal Acc. | AM827440 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ent-kaurene oxidase, chloroplastic OS=Arabidopsis thaliana E-value=9e-36; Cytochrome P450 98A1 OS=Sorghum bicolor E-value=2e-14; Cytochrome P450 71B21 OS=Arabidopsis thaliana E-value=2e-14; Flavonoid 3',5'-hydroxylase OS=Campanula medium E-value=3e-14; Cytochrome P450 71B22 OS=Arabidopsis thaliana E-value=3e-14; |
Length | 293 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_SL (1 ESTs); |
Sequence | ACGAAACCTGGAGAAAGCATAGTCCCGTACCTATAGTTCCTCTAAGATACGTCCACGAAG |
EST members of Unigene | AM827440 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832659 |
Trichome-related Gene from Literature | 832659 |