Detail of EST/Unigene AM827857 |
Acc. | AM827857 |
Internal Acc. | AM827857 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=4e-20; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=1e-19; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=2e-19; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=2e-18; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=2e-16; |
Length | 533 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_SL (1 ESTs); |
Sequence | TGGGGAATCTTCGTCATCGGACACGACTGCGGCCACCAAGCTTTCTCGAAAAACACGGAA |
EST members of Unigene | AM827857 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820387 |
Trichome-related Gene from Literature | 820387 |