| Detail of EST/Unigene AM834817 |
| Acc. | AM834817 |
| Internal Acc. | AM834817 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Actin, nonmuscle OS=Halocynthia roretzi E-value=2e-64; Actin, cytoplasmic OS=Biomphalaria obstructa E-value=4e-64; Actin, cytoplasmic OS=Biomphalaria tenagophila E-value=7e-64; Actin, cytoplasmic OS=Biomphalaria alexandrina E-value=7e-64; Actin, non-muscle 6.2 OS=Hydra vulgaris E-value=9e-64; |
| Length | 488 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_SL (1 ESTs); |
| Sequence | AGTAAACATAAAATTGATTTAAAATTAGCTAAGTTCCTAGAAGGTAACTAAACCAACTAA |
| EST members of Unigene | AM834817 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821411 |
| Trichome-related Gene from Literature | 821411 |