Detail of EST/Unigene AM843195 |
Acc. | AM843195 |
Internal Acc. | AM843195 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Putative aminotransferase YugH OS=Bacillus subtilis (strain 168) E-value=2e-10; Probable aspartate aminotransferase 1 OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) E-value=5e-10; Aspartate aminotransferase OS=Aquifex aeolicus (strain VF5) E-value=8e-09; Aspartate aminotransferase OS=Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099) E-value=1e-08; Tyrosine aminotransferase OS=Rattus norvegicus E-value=3e-08; |
Length | 522 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_DL (1 ESTs); |
Sequence | GCCAGATTCATTAAATTAGGACCTGCACCAAGTTTTGATATTAACTTTGAAGATATTGAA |
EST members of Unigene | AM843195 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
EC | 2.6.1.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816758 |
Trichome-related Gene from Literature | 816758 |