| Detail of EST/Unigene AM845607 |
| Acc. | AM845607 |
| Internal Acc. | AM845607 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Dynein intermediate chain 1, axonemal OS=Mus musculus E-value=9e-50; Dynein intermediate chain 1, axonemal OS=Bos taurus E-value=2e-49; Dynein intermediate chain 2, ciliary OS=Anthocidaris crassispina E-value=2e-49; Dynein intermediate chain 1, axonemal OS=Rattus norvegicus E-value=3e-49; Dynein intermediate chain 1, axonemal OS=Homo sapiens E-value=1e-48; |
| Length | 522 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_DL (1 ESTs); |
| Sequence | ATTGGGTAAATTATGCTTCAATCTTTGTATCTAGTGTCTCAAGTAGTTTCACCATCTTCT |
| EST members of Unigene | AM845607 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816471 |
| Trichome-related Gene from Literature | 816471 |