Detail of EST/Unigene AM845607 |
Acc. | AM845607 |
Internal Acc. | AM845607 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Dynein intermediate chain 1, axonemal OS=Mus musculus E-value=9e-50; Dynein intermediate chain 1, axonemal OS=Bos taurus E-value=2e-49; Dynein intermediate chain 2, ciliary OS=Anthocidaris crassispina E-value=2e-49; Dynein intermediate chain 1, axonemal OS=Rattus norvegicus E-value=3e-49; Dynein intermediate chain 1, axonemal OS=Homo sapiens E-value=1e-48; |
Length | 522 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_DL (1 ESTs); |
Sequence | ATTGGGTAAATTATGCTTCAATCTTTGTATCTAGTGTCTCAAGTAGTTTCACCATCTTCT |
EST members of Unigene | AM845607 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816471 |
Trichome-related Gene from Literature | 816471 |