Detail of EST/Unigene AW126122 |
Acc. | AW126122 |
Internal Acc. | N100319e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Peroxinectin A OS=Dictyostelium discoideum E-value=6e-11; Peroxidasin-like protein OS=Homo sapiens E-value=6e-06; Prostaglandin G/H synthase 2 OS=Gallus gallus E-value=6e-06; |
Length | 518 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS; |
Sequence | TGGACTTAGCTGCTCTTGAAATTTACAGGGATAGAGAGAGAGGTGTAGCAAGATATAACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K00430 peroxidase; Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00430 peroxidase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00430 peroxidase |
EC | 1.11.1.7 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821135 |
Trichome-related Gene from Literature | N/A |