| Detail of EST/Unigene AW126172 |
| Acc. | AW126172 |
| Internal Acc. | N100017e |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oligoribonuclease OS=Arabidopsis thaliana E-value=1e-65; Oligoribonuclease, mitochondrial OS=Rattus norvegicus E-value=2e-40; Oligoribonuclease, mitochondrial OS=Mus musculus E-value=2e-40; Oligoribonuclease, mitochondrial OS=Homo sapiens E-value=2e-40; Oligoribonuclease, mitochondrial OS=Bos taurus E-value=3e-40; |
| Length | 512 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ROOTPHOS; |
| Sequence | TGGATCCCCCGGGCTGCAGGTTACAGGTTACCTCTTGTCTGGATTGACTTGGAAATGACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.1.-.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817238 |
| Trichome-related Gene from Literature | N/A |