| Detail of EST/Unigene AW127322 |
| Acc. | AW127322 |
| Internal Acc. | M110493 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Dual specificity mitogen-activated protein kinase kinase 1 OS=Xenopus laevis E-value=5e-15; Dual specificity mitogen-activated protein kinase kinase dSOR1 OS=Drosophila melanogaster E-value=9e-15; Dual specificity mitogen-activated protein kinase kinase 1 (Fragment) OS=Serinus canaria E-value=3e-14; Dual specificity mitogen-activated protein kinase kinase 1 OS=Rattus norvegicus E-value=5e-14; Dual specificity mitogen-activated protein kinase kinase 1 OS=Oryctolagus cuniculus E-value=5e-14; |
| Length | 351 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | ACCGCCTCCGTTGCCGGTGGTGACAATATTAGTGCCGGTGACTTTGAAAAACTCTCCGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04368 mitogen-activated protein kinase kinase 1 |
| EC | 2.7.12.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843685 |
| Trichome-related Gene from Literature | N/A |