| Detail of EST/Unigene AW127327 |
| Acc. | AW127327 |
| Internal Acc. | M110498 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Triose phosphate/phosphate translocator, chloroplastic OS=Pisum sativum E-value=8e-24; Triose phosphate/phosphate translocator, chloroplastic OS=Brassica oleracea var. botrytis E-value=5e-07; Triose phosphate/phosphate translocator, chloroplastic OS=Spinacia oleracea E-value=7e-07; Triose phosphate/phosphate translocator TPT, chloroplastic OS=Arabidopsis thaliana E-value=7e-07; |
| Length | 319 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | GTTAACGAGAACCACAGGTACCAACACCAACATCATCCATATATCACTCTCTACTTGGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834652 |
| Trichome-related Gene from Literature | N/A |