Detail of EST/Unigene AW127368 |
Acc. | AW127368 |
Internal Acc. | M110541 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog MMK2 OS=Medicago sativa E-value=5e-60; Mitogen-activated protein kinase 2 OS=Oryza sativa subsp. japonica E-value=3e-50; Mitogen-activated protein kinase 4 OS=Arabidopsis thaliana E-value=9e-50; Mitogen-activated protein kinase 12 OS=Arabidopsis thaliana E-value=2e-48; Mitogen-activated protein kinase 6 OS=Oryza sativa subsp. japonica E-value=3e-48; |
Length | 346 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | GTCTGTTGAATCAGCTGAGAATAACATCAGAGGAATACCAACTCATGGTGGAAGGTATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04441 p38 MAP kinase |
EC | 2.7.11.24 2.7.1.37 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828151 |
Trichome-related Gene from Literature | N/A |