Detail of EST/Unigene AW127379 |
Acc. | AW127379 |
Internal Acc. | M110560 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=3e-19; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=8e-19; 30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-12; 30S ribosomal protein S17, chloroplastic OS=Zea mays E-value=2e-11; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Spinacia oleracea E-value=5e-07; |
Length | 332 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CAACAATGTGGCTTCTGCAACTTCCCAGCACGCTCTCAACACCATTCCTCAACGGCAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844324 |
Trichome-related Gene from Literature | 844324 |