Detail of EST/Unigene AW127399 |
Acc. | AW127399 |
Internal Acc. | M110582 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phospholipase A1-Igamma2, chloroplastic OS=Arabidopsis thaliana E-value=3e-36; Phospholipase A1-Igamma1, chloroplastic OS=Arabidopsis thaliana E-value=3e-35; Phospholipase A1-Igamma3, chloroplastic OS=Arabidopsis thaliana E-value=2e-30; Phospholipase A(1) DAD1, chloroplastic OS=Arabidopsis thaliana E-value=7e-16; Phospholipase A1-II 6 OS=Oryza sativa subsp. japonica E-value=3e-15; |
Length | 549 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | GCAAGACGCCAGCTCCAGACTCCATATCTTCATTCTCACTCCAACATGGCTGCATCAATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817604 |
Trichome-related Gene from Literature | N/A |