Detail of EST/Unigene AW127477 |
Acc. | AW127477 |
Internal Acc. | M110669 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | CMP-N-acetylneuraminate-poly-alpha-2,8-sialyltransferase OS=Bos taurus E-value=5e-12; CMP-N-acetylneuraminate-poly-alpha-2,8-sialyltransferase OS=Pan troglodytes E-value=9e-12; CMP-N-acetylneuraminate-poly-alpha-2,8-sialyltransferase OS=Homo sapiens E-value=9e-12; CMP-N-acetylneuraminate-poly-alpha-2,8-sialyltransferase OS=Mus musculus E-value=6e-11; CMP-N-acetylneuraminate-poly-alpha-2,8-sialyltransferase OS=Cricetulus griseus E-value=6e-11; |
Length | 319 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CAAGAGAGTATCTTGACGTTCGTCCTGGTGGTTGGGTAGATTATGCTCCACTAAGAATAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.4.99.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837388 |
Trichome-related Gene from Literature | N/A |