Detail of EST/Unigene AW171645 |
Acc. | AW171645 |
Internal Acc. | N100539e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,4-beta-xylanase Z OS=Clostridium thermocellum (strain ATCC 27405 / DSM 1237) E-value=2e-17; Endo-1,4-beta-xylanase OS=Penicillium simplicissimum E-value=2e-17; Putative endoglucanase type F OS=Fusarium oxysporum E-value=2e-16; Endo-1,4-beta-xylanase OS=Aspergillus aculeatus E-value=5e-16; Endo-1,4-beta-xylanase OS=Thermoascus aurantiacus E-value=2e-15; |
Length | 540 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS; |
Sequence | GAACCGTTCAACAATGGGTCAAGTCGCTGAATAAAAACGATCTGATGACGGCCGTTCAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842206 |
Trichome-related Gene from Literature | N/A |