| Detail of EST/Unigene AW171645 |
| Acc. | AW171645 |
| Internal Acc. | N100539e |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,4-beta-xylanase Z OS=Clostridium thermocellum (strain ATCC 27405 / DSM 1237) E-value=2e-17; Endo-1,4-beta-xylanase OS=Penicillium simplicissimum E-value=2e-17; Putative endoglucanase type F OS=Fusarium oxysporum E-value=2e-16; Endo-1,4-beta-xylanase OS=Aspergillus aculeatus E-value=5e-16; Endo-1,4-beta-xylanase OS=Thermoascus aurantiacus E-value=2e-15; |
| Length | 540 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ROOTPHOS; |
| Sequence | GAACCGTTCAACAATGGGTCAAGTCGCTGAATAAAAACGATCTGATGACGGCCGTTCAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842206 |
| Trichome-related Gene from Literature | N/A |