Detail of EST/Unigene AW171678 |
Acc. | AW171678 |
Internal Acc. | N100572e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acetolactate synthase 2, chloroplastic OS=Nicotiana tabacum SURB E-value=3e-67; Acetolactate synthase 1, chloroplastic OS=Nicotiana tabacum SURA E-value=3e-67; Acetolactate synthase 3, chloroplastic OS=Brassica napus E-value=1e-65; Acetolactate synthase 1, chloroplastic OS=Brassica napus E-value=1e-65; Acetolactate synthase, chloroplastic OS=Arabidopsis thaliana 1.2 E-value=2e-65; |
Length | 570 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS; |
Sequence | CATCGATGGTGATGGAAGTTTTATGATGAATGTTCAGGAATTGGCTACTATCAAGGTGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824015 |
Trichome-related Gene from Literature | N/A |