| Detail of EST/Unigene AW171706 |
| Acc. | AW171706 |
| Internal Acc. | N100600e |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 2-hydroxyisoflavanone synthase OS=Glycine max E-value=2e-73; Licodione synthase OS=Glycyrrhiza echinata E-value=4e-51; Cytochrome P450 93A3 OS=Glycine max E-value=5e-32; Cytochrome P450 93A1 OS=Glycine max E-value=2e-30; Cytochrome P450 93A2 OS=Glycine max E-value=1e-29; |
| Length | 607 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ROOTPHOS; |
| Sequence | ACCCACCACTACCCGTGGTGAAGAGAAAATGCACCGAAGAGTGTGAGATCAATGGTTATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817243 |
| Trichome-related Gene from Literature | N/A |