Detail of EST/Unigene AW171706 |
Acc. | AW171706 |
Internal Acc. | N100600e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-hydroxyisoflavanone synthase OS=Glycine max E-value=2e-73; Licodione synthase OS=Glycyrrhiza echinata E-value=4e-51; Cytochrome P450 93A3 OS=Glycine max E-value=5e-32; Cytochrome P450 93A1 OS=Glycine max E-value=2e-30; Cytochrome P450 93A2 OS=Glycine max E-value=1e-29; |
Length | 607 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS; |
Sequence | ACCCACCACTACCCGTGGTGAAGAGAAAATGCACCGAAGAGTGTGAGATCAATGGTTATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817243 |
Trichome-related Gene from Literature | N/A |