| Detail of EST/Unigene AW191261 |
| Acc. | AW191261 |
| Internal Acc. | T113542e |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alanine aminotransferase 1, mitochondrial OS=Arabidopsis thaliana E-value=1e-28; Alanine aminotransferase 2, mitochondrial OS=Arabidopsis thaliana E-value=5e-28; Alanine aminotransferase 2 OS=Panicum miliaceum E-value=3e-27; Alanine aminotransferase 2 OS=Hordeum vulgare E-value=2e-25; Alanine aminotransferase 2-like OS=Danio rerio E-value=2e-10; |
| Length | 234 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | CAATTACTTATTTCCGAGAGGTTCTTGCTTTATGTGACTATCCAGCTCTTCTGGACAAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
| EC | 2.6.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838301 |
| Trichome-related Gene from Literature | N/A |