Detail of EST/Unigene AW208095 |
Acc. | AW208095 |
Internal Acc. | M111130e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71B38 OS=Arabidopsis thaliana E-value=4e-10; Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=7e-10; Cytochrome P450 71B37 OS=Arabidopsis thaliana E-value=1e-09; Cytochrome P450 71B34 OS=Arabidopsis thaliana E-value=1e-09; Cytochrome P450 71B22 OS=Arabidopsis thaliana E-value=1e-09; |
Length | 316 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_IROOT_DSIR; |
Sequence | GCAATAGCTGAATAGCTATCCCTAATTCATGAACAAAAACATGTCACCCCTTATTCTTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07415 cytochrome P450, family 2, subfamily E |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828367 |
Trichome-related Gene from Literature | N/A |