Detail of EST/Unigene AW208205 |
Acc. | AW208205 |
Internal Acc. | M110853e |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferritin-3, chloroplastic OS=Vigna unguiculata E-value=2e-18; Ferritin-2, chloroplastic OS=Glycine max E-value=1e-16; Ferritin, chloroplastic OS=Malus xiaojinensis E-value=2e-16; Ferritin-1, chloroplastic OS=Glycine max E-value=2e-16; Ferritin-1, chloroplastic OS=Pisum sativum E-value=2e-13; |
Length | 370 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVSN; |
Sequence | GCGCCATTGTTAACCATTTCTCTTCCTTCAATCCTTTCTCAATTTTCTCAACGACCCTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831720 |
Trichome-related Gene from Literature | N/A |