| Detail of EST/Unigene AW255106 |
| Acc. | AW255106 |
| Internal Acc. | ML1399 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable linoleate 9S-lipoxygenase 5 OS=Solanum tuberosum E-value=3e-74; Probable linoleate 9S-lipoxygenase 7 OS=Solanum tuberosum E-value=5e-72; Linoleate 9S-lipoxygenase 6 (Fragment) OS=Solanum tuberosum E-value=8e-72; Probable linoleate 9S-lipoxygenase 4 OS=Solanum tuberosum E-value=8e-72; Linoleate 9S-lipoxygenase 2 OS=Solanum tuberosum E-value=1e-71; |
| Length | 514 nt |
| Species | Mentha x piperita |
| Belonged EST Libraries | MP_TRI (1 ESTs); |
| Sequence | TAGTGATCGAGGACTATCCCTATGCGGTGGACGGGCTCCAGATTTGGTCCGCCATAAGCA |
| EST members of Unigene | AW255106 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; ; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
| EC | 1.13.11.- 1.13.11.33 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841944 |
| Trichome-related Gene from Literature | 841944 |