| Detail of EST/Unigene AW255604 |
| Acc. | AW255604 |
| Internal Acc. | ML65 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-78; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=1e-77; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-77; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-54; 1-deoxy-D-xylulose-5-phosphate synthase OS=Mesorhizobium sp. (strain BNC1) E-value=5e-54; |
| Length | 618 nt |
| Species | Mentha x piperita |
| Belonged EST Libraries | MP_TRI (1 ESTs); |
| Sequence | CGACGGCCCCACCCACTGCGGCGCCTTCGACACGACCTACATGGCCTGCCTCCCAAACAT |
| EST members of Unigene | AW255604 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
| EC | 2.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |