| Detail of EST/Unigene AW256790 |
| Acc. | AW256790 |
| Internal Acc. | EST304927 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP24 10A, chloroplastic OS=Solanum lycopersicum E-value=4e-89; Chlorophyll a-b binding protein CP24 10B, chloroplastic OS=Solanum lycopersicum E-value=7e-89; Chlorophyll a-b binding protein CP24, chloroplastic OS=Spinacia oleracea E-value=6e-88; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=2e-27; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=4e-25; |
| Length | 631 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | AAATGGCAGCTGCAACATCTGGTGCTGTGTTGAATGGTTTGGGATCTTCCTTCTTATCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838151 |
| Trichome-related Gene from Literature | N/A |