| Detail of EST/Unigene AW256802 |
| Acc. | AW256802 |
| Internal Acc. | EST304939 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 87A1 OS=Arabidopsis thaliana E-value=1e-55; UDP-glycosyltransferase 87A2 OS=Arabidopsis thaliana E-value=5e-55; UDP-glycosyltransferase 86A2 OS=Arabidopsis thaliana E-value=7e-40; UDP-glycosyltransferase 86A1 OS=Arabidopsis thaliana E-value=3e-35; UDP-glycosyltransferase 76F1 OS=Arabidopsis thaliana E-value=3e-29; |
| Length | 714 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | TTTTACTCTATGTTGCATCATCTTGATGTGTTTTCACGAAAACATCACCTAACTGTTGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
| EC | 2.4.1.45 2.4.1.47 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817567 |
| Trichome-related Gene from Literature | N/A |