| Detail of EST/Unigene AW257026 |
| Acc. | AW257026 |
| Internal Acc. | EST305163 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=1e-07; Cytochrome P450 71B38 OS=Arabidopsis thaliana E-value=3e-07; Cytochrome P450 71B21 OS=Arabidopsis thaliana E-value=5e-07; Cytochrome P450 76C1 OS=Arabidopsis thaliana E-value=7e-07; 2-methylbutanal oxime monooxygenase OS=Manihot esculenta E-value=9e-07; |
| Length | 145 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | AACAACTCTTCCACCAGGTCCTAAAGGCCTTCCTTTCATTGGAAACTTACACCAACTTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07413 cytochrome P450, family 2, subfamily C |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829277 |
| Trichome-related Gene from Literature | N/A |