| Detail of EST/Unigene AW257064 |
| Acc. | AW257064 |
| Internal Acc. | EST305201 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase 3 OS=Arabidopsis thaliana E-value=5e-88; Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana E-value=1e-82; Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum E-value=3e-82; Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=1e-81; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=3e-81; |
| Length | 528 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | GCGTCCTTGAGTTTCCGGCGGTTCAGACTCACGGCGGACAGTTCGTTCAGTACAACGTGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04464 mitogen-activated protein kinase 7; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04464 mitogen-activated protein kinase 7 |
| EC | 2.7.1.- 2.7.11.24 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823706 |
| Trichome-related Gene from Literature | N/A |