| Detail of EST/Unigene AW257117 |
| Acc. | AW257117 |
| Internal Acc. | EST305254 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Isocitrate dehydrogenase [NADP], chloroplastic (Fragment) OS=Medicago sativa E-value=3e-60; Isocitrate dehydrogenase [NADP] OS=Glycine max E-value=2e-57; Isocitrate dehydrogenase [NADP] OS=Nicotiana tabacum E-value=2e-53; Isocitrate dehydrogenase [NADP] OS=Solanum tuberosum E-value=2e-52; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Microtus ochrogaster E-value=1e-35; |
| Length | 501 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV2; |
| Sequence | TATGGGGAAGAACCCAACCCTGGCATTCCCATCCATCAGACAAATGAAGCAAAAGTAGCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00031 isocitrate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00031 isocitrate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00031 isocitrate dehydrogenase |
| EC | 1.1.1.42 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842905 |
| Trichome-related Gene from Literature | N/A |